Notesale: Turn your study into money

Document Preview

Extracts from the notes are below, to see the PDF you'll receive please use the links above

---

Blueprint Series

Complete Solution
Chapter 5

5
FUNDAMENTAL MOLECULAR
GENETIC MECHANISMS

REVIEW THE CONCEPTS
1
...
These interactions result in primarily G-C and A-T base pairing
in DNA and A-U base pairs in double-stranded regions of RNA
...

2
...
As the temperature slowly drops below the Tm of the plasmid DNA, the
single-stranded oligonucleotide primer present at higher concentration than the
plasmid DNA strands hybridizes to its complementary sequence on the plasmid
template
...

3
...
Additionally, cytosine (found in both
RNA and DNA) may be deaminated to give uracil
...
In contrast, if this deamination occurs in RNA, which normally contains
uracil, the base substitution is not corrected
...
These properties might explain the use of DNA as a long-term
information-storage molecule
...
In prokaryotes, many protein-coding genes are clustered in operons where transcription proceeds from a single promoter that gives rise to one mRNA encoding
multiple proteins with related functions
...
Eukaryotic mRNAs also differ from their prokaryote counterparts in
that they contain a 5’ cap and 3’ poly(A) tail
...
In contrast, in eukaryotes, mRNA synthesis occurs in the
nucleus, whereas translation by ribosomes occurs in the cytoplasm
...

5
...
Specifically, the final exon of the gene could contain the information for the membrane-spanning domain, and in the smaller, secreted protein,
this exon could be omitted during splicing
...
An operon is an arrangement of genes in a functional group that are devoted to a
single metabolic purpose
...
In this manner,
the cell simply has to induce one promoter, which transcribes all the necessary
genes encoding the proteins (enzymes) to make the amino acid tryptophan
...
In addition, this arrangement allows all the genes
in an operon to be coordinately regulated by controlling transcription initiation
from a single promoter
...
Since poly(A)-binding protein is involved in increasing the efficiency of translation, a mutation in poly(A)-binding protein would cause less efficient translation
...

8
...
Thus, one strand is synthesized continuously at the growing fork,
but the other strand is synthesized utilizing Okazaki fragments that are joined
by DNA ligase
...
Base excision repair is responsible for repairing guanine-thymine mismatches
caused by the chemical conversion of cytosine to uracil or by deamination of
5-methyl cytosine to thymine
...
Nucleotide excision-repair fixes DNA strands that contain chemically modified bases, which ensures that thymine-thymine dimers are
repaired in the case of UV light damage
...
UV irradiation causes thymine-thymine dimers
...
The gap is
then filled in by DNA polymerase
...
Double-stranded breaks are repaired either by homologous
recombination or nonhomologous DNA end-joining
...
Nonhomologous DNA end-joining is errorprone because nonhomologous ends are joined together
...
Examples are
xeroderma pigmentosum due to mutations in XP genes that prevent repair of
thymine dimers and a genetic predisposition to breast cancer in individuals with
germ-line mutations in the BRCA1 or BRCA2 genes
...
Homologous recombination is the process that can repair DNA damage and also
generate genetic diversity during meiosis
...
During DNA repair by homologous recombination,
the damaged sequence is copied from an undamaged copy of the homologous
DNA sequence on the homologous chromosome or sister chromatid
...
Also, in meiosis an exchange called
crossing over is required for the proper segregation of the chromosomes during
the first meiotic cell division
...
The gene encoding the reverse transcriptase enzyme is unique in retroviruses
and closely related retrotrasposons
...
The human T-cell lymphotrophic virus,
which causes T-cell leukemia, and human immunodeficiency virus, which causes
AIDS, can infect only specific cell types because these cells possess receptors that
interact specifically with viral envelope proteins of the progeny virus
...


a
...
5’ACGGACUGUACCGCUGAAGUCAUGGACGCUCGA 3’

14
...


Prokaryotes

Eukaryotes

Very little non-coding DNA

Non-coding DNA (introns) interspersed
between coding regions (exons)

Genes that carry out similar/
complementary functions are
in tandem on the chromosome
(operon)
...


(cont
...


mRNA has to be translocated from the
nucleus to cytoplasm before protein
synthesis can begin
...
a
...

b
...

c
...

16
...


a
...
At the
same time, the template for the 5’ end of the other strand is continuously
revealed as the fork advances, therefore small 5’D3’ fragments need to
be synthesized on this strand
...
If the replication fork were moving in the opposite direction (left to right) to
the example shown above
...


The newly synthesized strand is the one with the error—if the original strand
were targeted, the mutation would be allowed to persist and would be transmitted to all subsequent cells
...


a
...
missense AUGDAUA (methionineDisoleucine)

CHAPTER 5: Fundamental Molecular Genetic Mechanisms

20
...


Lytic

19

Non-lytic

Infected cell ultimately dies
...


Viral genome does not integrate
into host genome; host cell DNA
destroyed
...


b
...
Viral mRNAs are transcribed by the host-cell translation machinery
...




---