Search for notes by fellow students, in your own course and all over the country.
Browse our notes for titles which look like what you need, you can preview any of the notes via a sample of the contents. After you're happy these are the notes you're after simply pop them into your shopping cart.
My Basket
Biology AS Level OCR A Revision Notes (full AS course - new spec for 2017)£2.50
Or: Edit My Basket
Title: Freshman Biology Extra Credit Vocab for Final Exam
Description: Beginner Biology, Second Semester extra credit vocab terms and definitions for Freshman final. Everything you need to know to get the extra credit and ace the exam.
Description: Beginner Biology, Second Semester extra credit vocab terms and definitions for Freshman final. Everything you need to know to get the extra credit and ace the exam.
Document Preview
Extracts from the notes are below, to see the PDF you'll receive please use the links above
Biotic factors all of the living organisms in an ecosystem (plants, animals, etc)
Abiotic factors all of the nonliving factors in an ecosystem (wind, nutrient
availability, soil type, sunlight, temperature, preciptiation, and humidity)
Species group of organisms so similar they can breed and produce fertile
offspring
Population a group of organisms that belong to the same species and live in the
same area
Community different populations that live together in a defined area (ex:
alligators, turtles, fish and plants in Florida everglades)
Ecosystem collection of all the organisms that live in a particular place, together
with their nonliving, physical environment
Biosphere all ecosystems on the planet or the zone of life on earth
Desert a region that has little or no vegetation, long periods without rain,
and extreme temperatures; usually found in warm climates
Savannah a plain full of grasses and scattered trees and shrubs; found in
tropical and subtropical habitats and mainly in regions with a dry climate,
such as East Africa
Temperate grassland a region that has cold winters and rainfall that is
intermediate between that of a forest and a desert; characterized by
extensive grasses and few trees
Tropical rainforest a region of forest or jungle that located near the
equator and that is characterized by large amounts of rain and little
variation in temperature
Taiga a region of evergreen, coniferous forest below the arctic and
subarctic tundra regions
Producer an organism that can make organic molecules from inorganic
molecules; a photosynthetic or chemosynthetic autotroph that serves as the
basic food srouce in an ecosystem
Autotroph an organism that produces its own nutrients from inorganic
substances or from the environment instead of consuming other organisms
Consumer an organism that eats other organisms or organic matter instead of
producing its own nutrients or obtaining nutrients from inorganic sources
Primary consumer the first thing that eats the producer makes up the
second trophic level
Secondary consumer the thing that eats the primary consumer makes
up the third trophic level
Tertiary consumer the thing that eats the secondary consumer makes
up the fourth trophic level
Heterotroph an organism that obtains organic food molecules by eating other
organisms or their byproducts and that cannot synthesize organic compounds
from inorganic materials
Carnivore an organism that eats animals
Herbivore an organism that eats only plants
Omnivore an organism that eats both plants and animals
Decomposer an organism that feeds by breaking down from dead organisms;
examples include bacteria and fungi
Trophic levels indicates the organism’s position in a series of energy transfers
Energy pyramid
A graphical odel
m
that is shaped like a pyramid to show how
the
energy
flows through a
food chain
, how the amount of
energy
is decreasing
and becoming less available for
organisms
as it enters each
trophic level
, and
how much of the
energy
in the
ecosystem
is lost to the
atmosphere heat
as
...
Acid rain rain that contains a high concentration of acids, often because
of the pollution of the atmosphere
Global warming The recent increase in the Earth's
average
atmospheric
temperature
due to an increase in the levels of
greenhouse gases
...
endangered is worse than threatened
Population density number of individuals per unit area
Exponential growth DRAW THIS (J shaped curve) occurs when the
individuals in a population reproduce at a constant rate; population
becomes larger and larger until it approaches an infinitely large size;
occurs under ideal conditions with unlimited resources
Logistic growth DRAW THIS (S shaped curve) as resources become
less available, the growth of a population slows or stops; occurs when a
population’s growth slows or stops after a period of exponential growth
Densitydependent limiting factors variables affected by the number of
organisms present in a given area, such as competition
Densityindependent limiting factors a variable that affects a population
regardless of the population density, such as climate, natural disasters,
human activities, etc
...
Gamete formation in humans
includes spermatogenesis and oogenesis; FEMALES PRODUCE ONE
MATURE EGG CELL ; IN MALES, A DIPLOID REPRODUCTIVE CELL
DIVIDES MEIOTICALLY TO FORM FOUR HAPLOID CELLS CALLED
SPERMATIDS each spermatid develops into a mature sperm cell
# of cells before and after meiosis eiosis I begins with a diploid (2n =
m
4
)
cell and ends with haploid (n = cells
...
23
GENETICS
Mendel researched heredity, remembered most for his research of garden peas
which led to the discovery of the basic principles of genetics
Karyotyping the process of determining a karyotype to detect chromosomal
abnormalities
...
Hybrid the offspring made by 2 different breeds
Punnett square diagram used to determine the gene combinations that can
result from a genetic cross
BE ABLE TO WORK ALL GENETIC PROBLEMS (SHOW EXAMPLES OF
THESE WITH ALL STEPS)
Complete dominance
More on the sheet…
...
WRITE CAUSES and SYMPTOMS
DNA & RNA
DNA the material that holds the info that determines inherited characteristics
(deoxyribonucleic acid)
Double helix
a pair of parallel helices intertwined about a common axis structure of
DNA
Watson & crick the two 20th century biologists who discovered the double helix
Rosalind Franklin & Xray diffraction
Genome the complete genetic material contained in an individual
List the 3 parts of a DNA nucleotide
List the 3 parts of an RNA nucleotide
Four bases of DNA
adenine (A) and guanine (G), Cytosine (C) and thymine (T)
Four bases of RNA adenine, guanine, and cytosine
...
Complementary base pairs A pairs with T (or U), and C pairs with G
Purines nitrogenous bases that have a doublering structure; either adenine or
guanine
Pyrimidines nitrogenous bases that have a singlering structure; thymine,
cytosine, or uracil
RNA ribonucleic acid a natural polymer that is present in all living cells and
that plays a role in protein synthesis
mRNA messenger RNA a singlestranded RNA molecule that encodes the
information to make a protein
rRNA ribosomal RNA an organelle that contains most of the RNA in the cell
responsible for ribosome function
tRNA transfer RNA an RNA molecule that transfers amino acids to the
growing end of a polypeptide chain during translation
Write the complementary strand for this DNA: (in packet)
AATTTGGACCCAATTTCCGGCCAT
TTAAACCTGGGTTAAAGGCCGGTA
Steps in replication
5’ → 3’
Okazaki fragments short, newly synthesized DNA
fragments
that are formed
on the lagging template strand during DNA replication
...
A
(smooth)
Lagging strand D strand that is used by DNA polymerase to make a new
NA
strand
...
" (not smooth motion)
Helicase an enzyme that separates DNA strands
DNA polymerase an enzyme that catalyzes the formation of the DNA molecule
Ligase
enzyme bind
that s two smaller pieces into one
single
structure
Transcription the process of synthesizing RNA by using one strand of a DNA
molecule as a template
Translation the portion of protein synthesis that takes place at ribosomes and
that uses the codons in mRNA molecules to specify the sequence of amino acids
in polypeptide chains
RNA polymerase an enzyme that starts the formation of RNA using a strand of
DNA molecule as a template
Mutations changes in the nucleotidebase sequence of a gene or DNA molecule
Silent mutation
do not cause changes in the
amino acid
sequence, leaving
protein
still functional
...
Nonsense utation
m
resulting in a stop
codon
that does not code for an
amino acid
and is not
transcribed
Addition utation
gene
m
where the
addition nucleotide
of
) causes a in the reading frame of the
shift
codons
in the RNA
m
, may cause
alteration
in the
amino acid
sequence
Deletion utation
gene
m
where the deletion of
nucleotide
) causes a in the reading frame of the
shift
codons
in the RNA
m
, may cause
alteration
in the
amino acid
sequence
Frameshift an addition or deletion which causes the reading frame to shift
Codon in DNA, a threenucleotide sequence that encodes an amino acid or
signifies a start signal or a stop signal
Anticodon a region of tRNA that consists of three bases complementary to the
codon of mRNA
Start codon
Stop codon
Deterine the mRNA strand and the amino acid sequence from the following
strand of DNA (use the amino acid chart!) (see packet)
Gene regulation echanism used by a cell to increase or decrease the production of
m
protein or RNA
...
Red blood cells discshaped cells that have no nucleus, contain hemoglobin,
transport oxygen in the circulatory system
White blood cells a type of blood cell that destroys bacteria, viruses, and toxic
proteins helps the body develop immunities
Platelets fragments of a cell that form blood clots
Arteries blood vessels that carry blood away from the heart to the body’s organs
Capillaries tiny blood vessels that allow an exchange between blood and cells
in tissue
Veins vessel that carries blood to heart
Structure of the heart (LABEL AND DIAGRAM)
-
Pulmonary vs systemic circuit - pulmonary circuit = blood takes up oxygen in the lungs
...
average/ideal resting heart rate, blood pressure, pulse
Hypertension a condition of high blood pressure
Heart murmur
Function of skeletal system
Major joints
Ligaments a type of connective tissue holds together the bones in a joint
Axial vs appendicular skeleton
Different types of fractures
Function of the muscular system
Smooth muscle elongated muscle that is not under voluntary control and
that is found in the digestive tract, blood vessels, glands, and hair follicles,
but not in the heart
Cardiac muscle the type of involuntary muscle found in the hear
Skeletal muscle a voluntary muscle that is attached to the bones and that
moves part of the body
Voluntary vs involuntary you can choose when to move it vs moves on its
own
Tendons tissues that attach a muscle to a bone or to another body part
Function of integumentary (skin) system
Know the layers of the skin
Be able to differentiate between three types of burns
Function of the digestive system and major organs
Mechanical vs chemical digestion echanical digestion
M
= physically
breaking the food into smaller pieces
...
Chemical digestion
= breaking down the food into simpler
nutrients that can be used by the cells
...
Function of the nervous system
Different types of nerons
Structure of a nerve cell
Reflex involuntary, almost immediate movement in response to a
stimulus
Parts of the brain and their functions
Divisions of the nervous system
Function of the respiratory system
Pathway of air in and out of lungs
Common respiratory illnesses
Function of the immune system
Immune response the reaction of the body against an antigen
1st, 2nd, 3rd line of defense
B cells white blood cells that mature in bones and make antibodies
T cells cells that derive from the thymus and that participate in many
immune reactions
White blood cells cell in the blood that destroys bacteria, viruses, and
toxic proteins and helps the body develop immunities
Lymphocytes type of white blood cell that exists in two primary forms, T
cells and B cells
Phagocytes cells that ingest and destroy (digest) foreign matter or
microorganisms
Macrophages an immune system cell that engulfs pathogens and other
materials
Antigens substances that stimulate an immune response
Antigenic shift
when two or more different strains of a virus, or strains of
two or more different viruses, combine to form a new subtype having a
mixture of the surface antigens of the two or more original strains
...
Antibodies proteins that react to a specific antigen or that inactivates or
destroys toxins
Allergies physical responses to an antigen, which can be a common
substance that produces little or no response in the general population
Histamine a chemical that stimulates the autonomous nervous system,
secretion of gastric juices, and dilation of capillaries
Autoimmune diseases diseases in which the immune system attacks the
organism’s own cells
Vaccine the administration of material from a pathogen into animals to
induce an immune response
Passive immunity
short-term (does not stimulate an immune
response); includes: artificially acquired passive immunity and
naturally acquired passive immunity
Active immunity term (stimulates an immune response);
long
includes: naturally acquired active immunity and artificially acquired
active immunity
Natural immunity
Naturally acquired active immunity occurs when the person
is exposed to a live pathogen, develops the disease, and becomes immune as a
result of the primary immune response
...
Ring vaccinations controls an outbreak by vaccinating and monitoring a
ring
of people around each infected individual like if you get sick then
your whole family gets vaccinated
END OF BIOTECHNOLOGY
Regenerative medicine process of replacing, engineering or regenerating
human cells, tissues or organs to restore or establish normal function
Telomere a repeated DNA sequence that is found at the end of chromosomes
and that shortens with each cell division
Telomerase
an enzyme that adds nucleotides to telomeres, especially in cancer cells
Title: Freshman Biology Extra Credit Vocab for Final Exam
Description: Beginner Biology, Second Semester extra credit vocab terms and definitions for Freshman final. Everything you need to know to get the extra credit and ace the exam.
Description: Beginner Biology, Second Semester extra credit vocab terms and definitions for Freshman final. Everything you need to know to get the extra credit and ace the exam.